Immunocytochemistry Cells were fixed at room temperature wit

Immunocytochemistry. Cells were fixed at room temperature with 4% paraformaldehyde for 10min. Non-specific proteins were blocked by ultra V block (Thermo). The cells were then treated with primary AZD7762 overnight at 4°C. Primary antibodies were against TRA-1-60 (1:500, MA1-023, Thermo Fisher), OCT4 (1:500, C30A3, Cell Signalling), and SSEA3 (1:100, MAB4303, Millipore). After washing with PBS, the cells were incubated with fluorescence-conjugated secondary antibody AlexaFluor 488: donkey anti-goat (1:500, A11055, Life Technologies), goat anti-mouse (1:500, A21042, Life Technologies), goat anti-rat (1:500, A21212, Life Technologies) for 45min, and finally mounted to cover-slip with Vectashield mounting medium with DAPI (Vectorlabs). Quantitative polymerase chain reaction (qPCR). Total RNA was extracted using RNA Spin II (Macherey-Nagel) by following the manufacturer\'s instructions. Briefly, first-strand cDNA was synthesized from 2μg total RNA by SuperScript III reverse transcriptase (Invitrogen) with oligo dT primer (Invitrogen) in 20μl volume. 1% of above cDNA was used for each qPCR reaction in a 20μl mixture containing 10μl of SYBR green-Taq mixed solution (Sigma) and 5μl of 2μM-primer mix. PCR reactions were carried out in a Corbette thermal cycler (Qiagen) for 40cycles and each cycle contained 95°C for 15s, 60°C for 30s and 72°C for 30s. RNA without reverse transcription was used as a negative control. The relative expression level of genes was calculated by calibrating their CT values with that of the housekeeping gene Cyclophilin G. Primer sequences (5′→3′) were as follows: OCT4_endoF: TTGGGCTCGAGAAGGATGTG; OCT4_endoR: TCCTCTCGTTGTGCATAGTCG; SOX2_endoF: GCCCTGCAGTACAACTCCAT SOX2_endoR: TGCCCTGCTGCGAGTAGGA; NANOG-F: CTCAGCCTCCAGCAGATGC; NANOG-R: TAGATTTCATTCTCTGGTTCTGG; TDGF1-F: TCAGAGATGACAGCATTTGGC; TDGF1-R: TTCAGGCAGCAGGTTCTGTTTA; SeV-F: GGATCACTAGGTGATATCGAGC; SeV-R: ACCAGACAAGAGTTTAAGAGATATGTATC; GAPDH-F: GGTCATCCATGACAACTTTGG; GAPDH-R: TGAGCTTCCCGTTCAGCTC. Demonstration of three germ layer differentiation capacity. About 200,000 morphologically intact iPSC were intratesticularly injected into male NMRI nude mice (Scanbur). The resulting tumors were collected 8weeks after injection, fixed with 10% formalin, and hematoxylin and eosin stained. The experimental animal welfare committee of the District Government of Southern Finland approved the animal experiments. Verification and authentication. Chromosomal G-band analyses were performed at the Yhtyneet Medix Laboratoriot, Finland (http://www.yml.fi/). Authentications, HEL47.2 and its parental fibroblast line (M83) showed the same 46,X, abn (Y) karyotype.
Resource table: Resource details To generate HEL24.3 we have used four Yamanaka reprogramming factors: Oct3/4, Sox2, Klf4, and cMyc.
Materials and methods Cell culture and reprogramming.Healthy human foreskin fibroblasts (http://www.lgcstandards-atcc.org/products/all/CRL-2429) were cultured in DMEM (Sigma) supplemented with 10% FBS (Life Technologies) and GlutaMAX (Life Technologies). Fibroblasts were reprogrammed using CytoTuneTM-iPS Sendai Reprogramming Kit (https://www.lifetechnologies.com/order/catalog/product/A1378001) using the method described (REFF: SCR-D-14-00142). To enhance the reprogramming of fibroblasts 0.25mM sodium butyrate (NaB; Sigma, B5887) was added to all reprogramming experiments. HEL24.3 was cultured in hESC medium: DMEM/F12 with GlutaMAX (Life Technologies), 10% KnockOut Serum Replacement (Life Technologies), 0.1mM 2-mercaptoethanol (Life Technologies), 1× Non-Essential Amino Acids (Life Technologies), and 6ng/ml bFGF (Sigma) and routinely propagated with combination of collagenase IV treatment and mechanic dissociation. HEL24.3 was subsequently adapted and culture in a feeder free conditions on matrigel in the presence of E8 medium (Life Technologies). iPSC lines were routinely split using 0.5mM EDTA and thawed in the presence of Rho-kinase inhibitor (Y-27632, Sigma) during 24h after thawing.